Molecular Basis of Inheri question bank (Biology)

In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows the expression of $\beta$-galactosidase. When X-gal (a synthetic substrate) is added to the medium, $\beta$-galactosidase converts it into a blue-coloured compound. In an experiment, the $\beta$-galactosidase coding sequence was replaced with a T7RNA polymerase coding sequence downstream to the lac operator region (lacO). The $\beta$-galactosidase coding sequence was inserted into a plasmid under the control of T7 promoter (that allows binding of only T7-RNA polymerase). When another factor $\mathbf{Y}$ is produced in this cell, it binds and blocks the activity of T7-RNA polymerase. Based on this information, choose the correct statement.

Shotgun method was used for sequencing a stretch of DNA wherein the molecule was broken into small fragments and each fragment was sequenced. The DNA sequence was then assembled by identifying the overlaps. The 5'-3' sequence of the fragments $(\mathbf{I}-\mathbf{V})$ are given below: (I) GGCTCAAGGAGAGGG (II) CCGTCAAAAAAATTTAACCCTT (III) CCCTTAAGGAGAGAGGATTAGGA (IV) GGGAATTATACCGT (V) GGATACCTTTT Identify the alignment of the fragments to determine the correct DNA sequence.